Stemness state regulators SALL4 and SOX2 are involved in progression and invasiveness of esophageal squamous cell carcinoma
- 697 Downloads
- 29 Citations
Abstract
Cancer stem cells, as a subgroup of tumor cells, resemble critical properties of embryonic stem cells (ESCs) such as self-renewal and maintenance of stemness state. SALL4 and SOX2 are two main transcription factors involving in maintenance of pluripotency, self-renewal and cell fate decision in ESCs. In this study, we aimed to elucidate the expression levels of these important transcription factors in esophageal squamous cell carcinoma (ESCC) and to reveal their probable roles in maintenance and progression of the disease. The expression level of SALL4 and SOX2 was analyzed in fresh tumoral tissues in comparison with distant tumor-free tissues of 50 ESCC patients by relative comparative real-time PCR. SALL4 and SOX2 were overexpressed in 64 and 32 % of tumor samples, respectively, in significant correlation with each other (p = 0.028). There was a significantly inverse correlation between low level of SALL4 expression and metastasis of tumor cells into the lymph nodes (p = 0.035). Furthermore, co-overexpression of the genes was significantly correlated with the depth of tumor invasion (p = 0.045) and metastasis to the lymph nodes (p = 0.049). SALL4 and SOX2 are co-overexpressed in ESCC and have a significant correlation with invasion and metastasis of the disease. To the best of our knowledge, this is the first report of SALL4 clinical relevance in ESCC to date. The clinical consequences of SALL4–SOX2 association suggest a possible functional interaction between these factors in regulation of ESCC maintenance and aggressiveness and introduce these regulators of stemness state as potentially interesting therapeutic targets to bring new opportunities for onco-therapeutic modalities.
Keywords
SALL4 SOX2 Stemness state ESCC Cancer stem cellIntroduction
Cancer stem cells (CSCs) are identified as a subset of tumor cells with ability of self-renewal and stemness state maintenance, as well as initiation and maintaining of a tumor. Highly specific regulatory transcriptional networks in CSCs make them more resistant than other tumor cells to chemo- and radio-therapy [1]. CSCs are discovered in esophageal squamous cell carcinoma (ESCC) [2]. Due to the late diagnosis of the ESCC till an advanced stage and a poor understanding of the molecular mechanisms underlying initiation and progression of the disease, mechanism of ESCC development is not well understood. Therefore, role elucidation of important elements in regulatory transcriptional networks of CSCs which govern cancer maintenance and progression can enhance our knowledge of cancer biology and introduce novel therapeutic targets for effective cancer treatment strategies.
SALL4 is a C2H2 zinc-finger transcription factor involved in normal development and plays roles in maintenance of pluripotency and self-renewal of embryonic stem cells (ESCs) [3]. It is also engaged in maintenance, proliferation/stabilization and cell fate decision of human adult stem cells [4]. On account of ESCs context, the transcription factor SALL4 activates or represses various transcriptional networks involved in self-renewal and stemness state through regulatory interaction with either crucial transcription factors or chromatin remodeling complexes [5]. Several studies have identified the overexpression of SALL4 in different malignancies such as breast, liver and colorectal cancers. Overexpression of SALL4 is reported in majority of breast and colorectal cancers, in correlation with the early steps of tumors and lymph node metastasis, respectively [6, 7]. Furthermore, it is suggested that SALL4 is related to poor prognosis and aggressiveness of liver cancer [8].
SOX2 [sex determining region Y (SRY)-box 2] is a member of the SRY-related high-mobility group (HMG)-box transcription factors which contain a single HMG box DNA-binding domain [9]. It is expressed through different developmental stages and characterized by several tissue-specific functions in stem cells. SOX2 is an important key transcription factor involved in self-renewal and pluripotency characteristics of undifferentiated ESCs [10]. Furthermore, it is a member of master transcriptional complex consisting of OCT4/SOX2/NANOG which can reprogram differentiated cells to induced pluripotent stem (iPS) cells [11]. Deregulation of SOX2 gene expression has been found in several types of human malignancies including glioblastomas and melanomas [12, 13], gastric [14], breast [15], lung [16] and prostate cancers [17]. A direct correlation is reported between SOX2 protein expression and invasiveness/metastasis potentials of various solid tumors. In line with such finding, it has been shown that SOX2 down-regulation can decrease invasiveness potential of gliomas, melanomas and colorectal cancer cells [13, 18, 19].
Considering the role of this regulatory transcriptional network in maintenance of stemness state and self-renewal of CSCs, we aimed in this study to elucidate the expression levels of SALL4 and SOX2 in ESCC and reveal their probable correlations with maintenance and progression of the disease. Furthermore, we reviewed different apparent connections between SALL4 and SOX2 in ESCs to emphasize the importance of similar networks in CSCs and their possible roles in ESCC maintenance and development.
Materials and methods
Study population
The fresh tumoral and distant tumor-free tissues of the esophagus were obtained from 50 ESCC patients after the therapeutic surgery at Omid Oncology Hospital of Mashhad University of Medical Sciences (MUMS), Mashhad, Iran. None of the enrolled patients had experienced preoperative chemo- or radio-therapy. The histopathological features of the samples were defined based on the seventh edition of Union International Cancer TNM classification guidelines [20]. The study was approved beforehand by the Ethics Committee of the MUMS, and the declared consent of all patients for enrollment in this study is on record at the MUMS.
RNA extraction, cDNA synthesis and quantitative RT-PCR
Primer sequences used for quantitative real-time RT-PCR
| Gene | Forward | Reverse |
|---|---|---|
| SALL4 | CCAAAGGCAACTTAAAGGTTCAC | CCGTGAAGACCAATGAGATCTC |
| SOX2 | AGCTACAGCATGCAG | GGTCATGGAGTTGTACTG |
| GAPDH | GGAAGGTGAAGGTCGGAGTCA | GTCATTGATGGCAACAATATCCACT |
Statistical analysis
Statistical analyses were conducted using the SPSS version 19.9 statistical package (SPSS, Chicago, IL). The χ 2 or Fisher exact test, independent-sample t test and ANOVA were mainly used to correlate gene expression with different clinical features. The correlation between SALL4 and SOX2 expression was assessed using Pearson’s correlation. p < 0.05 was considered statistically significant.
Results
Study population
Clinicopathological features of the enrolled patients and correlation of SALL4 and SOX2 mRNA expression with them
| Factor | # | SALL4 | SOX2 | Co-overexpression of the genes (p value) | ||
|---|---|---|---|---|---|---|
| ↑ | −/↓ | ↑ | −/↓ | |||
| Sex | ||||||
| Male | 24 | 15 | 9 | 7 | 17 | 0.091 |
| Female | 26 | 16 | 10 | 9 | 17 | |
| Metastasis | ||||||
| No metastasis | 28 | 15 | 13 | 6 | 22 | 0.045* |
| Node metastasis | 22 | 16 | 6 | 10 | 12 | |
| Depth of tumor invasion | ||||||
| T1,2 | 11 | 10 | 1 | 3 | 8 | 0.026* |
| T3,4 | 39 | 21 | 18 | 13 | 26 | |
| Stages | ||||||
| I/II | 31 | 19 | 12 | 9 | 22 | 0.011* |
| II/IV | 19 | 12 | 7 | 7 | 12 | |
| Grade of differentiation | ||||||
| PD | 6 | 2 | 4 | 0 | 6 | 0.213 |
| MD | 33 | 24 | 9 | 12 | 21 | |
| WD | 11 | 5 | 6 | 4 | 7 | |
| Location | ||||||
| Lower | 22 | 13 | 9 | 5 | 17 | 0.593 |
| Middle | 26 | 17 | 9 | 11 | 15 | |
| Upper | 2 | 1 | 1 | 0 | 2 | |
Upregulation of SALL4 and SOX2 mRNA expression in ESCC
Scatter plot representative of descriptive analysis of gene expression distribution of SALL4 and SOX2 in the ESCC patients. The y-axis indicates the fold change of gene expression, and the x-axis represents the number of patients. Relative mRNA expression of more than twofold in tumor tissues compared with tumor-free margins is considered as overexpression, less than minus twofold as underexpression, and the range in between is defined as normal expression or no change
SALL4 affects SOX2 mRNAs expression in ESCC
Association between expression patterns of SALL4 and SOX2
| SOX2 | p value | ||
|---|---|---|---|
| Normal/underexpression | Overexpression | ||
| SALL4 | |||
| Normal/underexpression | 16 | 3 | 0.028* |
| Overexpression | 18 | 13 | |
Regression plot representing correlation between SALL4 and SOX2 mRNA expression (q = 0.328, p = 0.012)
Clinicopathological relevance of SALL4 and SOX2 expression in ESCC
There was a significantly inverse correlation between low level (underexpression) of SALL4 expression and metastasis of tumor cells into the lymph nodes (p = 0.035). In fact, the aggressiveness and metastasis of ESCC cells to the lymph node was decreased through declining in SALL4 mRNA expression. Interestingly, in such samples with low level of SALL4 expression, underexpression of SOX2 was also inversely correlated with the lymph node metastasis (p = 0.045). This may emphasize the coordinating role of SALL4 and SOX2 in ESCC metastasis. Another significant results which confirm this role was seen in SALL4 overexpressed tumor samples, where high level of SOX2 mRNA expression was not only associated with the lymph node metastasis (p = 0.049), but also correlated with the depth of tumor invasion (p = 0.045).
To clarify and confirm what we found at the first look, a similar set of statistical analyses were conducted on the split samples based on their state in level of the gene expression. Interestingly, we found significant inverse correlation between SALL4 low level of gene expression and stage of tumor progression (p = 0.030), metastasis of tumor cell into the lymph nodes (p = 0.006), and the number of involved lymph nodes (p = 0.014) in tumor samples with low levels of both SALL4 and SOX2 gene expression. Furthermore, in samples which overexpressed both genes, SOX2 was significantly correlated with the stage of tumor progression (p = 0.011), depth of tumor invasion (p = 0.026), metastasis of tumor cells into the lymph nodes (p = 0.045) and the number of involved lymph nodes (p = 0.033). The correlations between co-overexpression of the genes and clinicopathological features of the patients are summarized in Table 2.
Discussion
Normal and CSCs show similarities in different aspects such as gene expression profile, activated cell signaling pathways and epigenetic modifications which play important roles in cell fate decision. CSCs, as a subgroup of tumor cells, contain specific mechanisms and molecular networks contributed to cancer initiation and progression, as well as therapeutic resistance. Having established a tumor, CSCs are able to sustain tumor mass growth and development leading to metastasis of the cells [1]. Therefore, it is tempting to speculate the existence of master regulatory transcriptional network of ESCs consisting of (but not limited to) SALL4 and SOX2 in CSCs. Our results may confirm such extrapolation for ESCC.
Here we demonstrated the significant overexpression of SALL4 and SOX2 in ESCC tissues and illustrated significant correlation between the expressions of these genes. Furthermore, we revealed the clinical relevance of SALL4 and SOX2 in ESCC and demonstrated that high levels of both genes’ expression were associated with progression and lymph node metastasis of tumor cells, suggesting that SALL4/SOX2 transcription factors play important roles in the beginning and continuing of ESCC invasion and metastasis.
SALL4, a member of the SALL (Spalt-like) family of zinc finger transcription factors, is homologue of homeotic gene (Spalt) of Drosophila which is essential for development [3]. It contains multiple C2H2 zinc finger motifs, which are evenly distributed over the protein. SALL4 is a stemness factor which not only plays important roles in embryonic development, maintaining pluripotency and self-renewal state of ESCs, but also elicits reprogramming of somatic cells and determines cell fate decision [5]. SALL4 has a direct interaction with key molecules of cell signaling pathways such as Wnt/β-catenin and BMI-1 to maintain the pluripotency of ESCs during embryogenesis [5].
SOX2 is a master regulator of pluripotency and self-renewal in ESCs and a variety of adult stem cells. This protein is a member of evolutionarily conserved stem cell transcription factors containing a SRY-related HMG box. In addition, SOX2 is known as lineage-survival oncogene which is essential for the expression signature of pluripotent stem cell (PSCs) and the lineage-specific genes in lung squamous cell carcinoma (SCC). Ectopic expression of SOX2 in normal trachea bronchial epithelial cells generates the oncogenic transformation of the cells [22]. Recent studies suggest the oncogenic roles of SOX2 in the organization of SCC in several organs such as esophagus, where it is principally expressed in the basal progenitor cells of the stratified epithelium [23]. It is also expressed mainly in other types of poorly differentiated and aggressive human cancers [24].
Using proteomics screening of SOX2-associated proteins, Mallanna et al. demonstrated that SOX2 interacts with more than 60 nuclear proteins during the early stages of ESCs development. In addition, they showed that SOX2-associated proteins have interactions with other pluripotency factors including SALL4, NANOG, OCT4 and ESRRB in ESCs and specifically identified the interaction of SALL4 with nearly 12 % of SOX2-associated proteins [25]. These finding illustrate the involvement of a complex regulatory network consisting of master proteins such as SOX2 and SALL4 in maintenance of self-renewal and stemness state of ESCs. This regulatory network may be present in CSCs as well. Since our results showed co-overexpression of SALL4 and SOX2 in ESCC and also their significant correlation, we can extrapolate the existence of similar regulatory network in ESCC and its significant involvement in maintenance and progression of the disease through direct or indirect mechanisms in both mRNA and protein levels.
It has been shown that SOX2 overexpression is critical for survival and migration of epithelial cells in lung SCC [26]. SOX2 overexpression has been reported in several solid tumors. The elevated expression of SOX2 was indicated in 95 and 90 % of ESCCs and lung cancers, respectively, where this stemness marker is suggested to be involved in early stages of both cancers’ tumorigenesis [27, 28]. Aberrant expression of SOX2 is identified in significant correlation with the invasiveness state of tumor cells. SOX2 overexpression is correlated with highly invasive and metastatic colorectal cancers and gliomas, while its knockdown decreases aggressiveness of melanomas, gliomas and colorectal tumor cells [13, 18, 19]. It has been reported that SOX2 silencing can induce mesenchymal–epithelial transition (MET) in colorectal cancer cells and causes a significant decline in cell mobility and invasion in vitro and metastasis in vivo [18]. Furthermore, it has been shown that SOX2 overexpression can deregulate cell cycle in breast cancer cell line (MCF7) leading to enhanced cell proliferation and tumorigenesis [29].
Recent studies demonstrated that SALL4 is a metastatic marker for colorectal, endometrial and gastric cancers, and co-overexpression of SALL4 and SOX2 genes plays essential roles in metastasis of laryngeal SCC, breast and liver malignancies. In line with these studies, here we also elucidated the metastatic role of SALL4 and SOX2 in ESCC and introduced these markers as important factors contributed to the invasion and aggressiveness of the disease.
SALL4 plays different roles in the cell. a SALL4 and NANOG can be autoregulated through feed forward loops to maintain their expression in the cell. SALL4/NANOG can binds to the upstream regulatory sequences of OCT4 and SOX2 genes. Furthermore, SALL4, BRG1 and HDAC1 are associated with the promoter regions of the genes which are activated by regulatory complex consisting of S0X2, OCT4 and NANOG and are involving in the pluripotency and self-renewal. b BMI-1, polycomb ring finger oncogene, is a direct target gene of SALL4 which regulates expression of cell cycle inhibitors such as p16 and p19 and can cause cell cycle progression. c SALL4 and SOX2 may coordinate through WNT/β-catenin pathway. SALL4 and SOX2 are able to interact with β-catenin leading to self-renewal and cell proliferation. SOX2 also can maintain its function of transcriptional regulation through interacting with β-catenin. d SALL4 can enhance somatic cell reprogramming by recruiting the stemness state regulatory transcriptional network consisting of SOX2, OCT3/4, KLF4 and c-MYC reprogramming factors
Genome-wide DNA-binding analysis explained that SOX2, OCT4 and NANOG, form a core transcriptional complex which bind to a large group of genes which code for SOX2-associated proteins in ESCs [29]. Furthermore, it indicated the existence of regulatory transcriptional networks which is controlled by SALL4 and eventually led to controlling of the ESCs pluripotency [31]. Interestingly, it has been shown that SALL4, BRG1 and HDAC1 are associated with the promoter regions of the genes which are activated by regulatory complex consisting of S0X2, OCT4 and NANOG in ESCs [31, 32] and are involving in the pluripotency and self-renewal of ESCs [25]. Such interaction between SALL4 and SOX2 in ESCs may be mimicked in CSCs as well to maintain self-renewing of the cells in tumor mass. Co-overexpression of these genes in ESCC and their significant clinicopathological relevance may confirm crucial importance of this regulatory network in ESCC development (Fig. 3a).
It has been detected that SALL4 overexpression is associated with BMI-1 promoter H3–K4 and H3–K79 histone methylation in leukemic stem cells, providing a link between SALL4 and polycomb group proteins in regulation of normal and CSCs self-renewal [5]. Since BMI-1 expression declines with differentiation, SALL4-mediated BMI-1 gene expression through epigenetic mechanism may inhibit cell differentiation. BMI-1, polycomb ring finger oncogene, is a direct target of SALL4 gene which regulate expression of cell cycle inhibitors such as p16 and p19. He et al. [33] have indicated that BMI-1 is overexpressed in early stages of ESCC and inversely correlated with the well-differentiated state of tumor cells, leading to ESCC progression. Such data may emphasize the existence of similar connection between SALL4 and BMI-1 in esophageal CSCs self-renewing and ESCC progression (Fig. 3b).
SALL4 and SOX2 are able to interact with the WNT/β-catenin pathway components in HSCs/CML and breast cancer, respectively. Chen et al. [29] reported that SOX2 protein maintains its function of transcriptional regulation through interacting with β-catenin in breast cancer cells. On the other hand, blocking of canonical WNT/β-catenin signaling inhibits SOX2 expression in retina development, which leads to reduced cell proliferation [34]. Based on these evidences, it is clear that SALL4 and SOX2 may coordinate through WNT/β-catenin pathway. Interestingly, we have previously reported high expression of PYGO2, the main transcription factor of WNT signaling pathway transcriptional machinery, in ESCC in correlation with advanced stages and tumor invasion of the disease [35]. Having combined such in line observations, we may hypothesize the probable interactions between SALL4/SOX2 and WNT pathway in ESCC which can enhance carcinogenesis and aggressiveness of the disease (Fig. 3c).
There is a close relationship between SALL4 and implicated master transcription factors in molecular regulatory network which maintain ESCs pluripotency, including SOX2, OCT3/4, KLF4, c-MYC and NANOG [5]. The coordination between SALL4 and these critical transcription factors can induce reprogramming of differentiated cells to a stemness state of iPS cells, while, down-regulation of SALL4 causes down-regulation of all these genes during somatic cell reprogramming process [5]. Recent studies clearly demonstrated that SALL4 can enhance somatic cell reprogramming by recruiting the stemness state regulatory transcriptional network consisting of SOX2, OCT3/4, KLF4 and c-MYC reprogramming factors [5]. Such observations suggest that SALL4 and SOX2 play a vital role not only in regulation of ESCs self-renewal and pluripotency, but also in reprogramming process of different type of differentiated cells through interaction with core transcription factors of multiple stem cell signaling pathways. Our results may confirm such suggestion for ESCC. Co-overexpression of the genes in ESCC was significantly correlated with the different behaviors of the tumor cells including stage of tumor progression, depth of tumor invasion, metastasis of tumor cells into the lymph nodes and also the number of involved lymph nodes. These results highlight the importance of SALL4 and SOX2 gene expression in ESCC maintenance, progression and metastasis and emphasize the regulatory role of SALL4/SOX2 transcriptional network in the beginning and continuing of ESCC transformation, invasion and metastasis. Indeed, if we accept the existence of CSCs as a subgroup of tumor cells in ESCC, we have to consider such critical roles for these stem cell markers in establishment of the disease (Fig. 3d).
In conclusion, SALL4 functions in the ESCs (and probably CSCs) through a variety of protein–DNA and protein–protein interactions with crucial factors involved in maintenance of stemness state, self-renewal and pluripotency of the cell. It has not only a close cooperation with master regulators of stemness state including SOX2, OCT4 and NANOG, but also has a direct impact on major cell signaling pathways such as WNT/β-catenin in the cell, leading to cell survival and proliferation. To the best of our knowledge, the present study shows several interesting results for the first time in ESCC to date. We elucidated the co-expression pattern of two stemness regulatory transcription factors SALL4 and SOX2 in ESCC and found a significant correlation between the co-overexpression of these markers and invasion/metastasis of ESCC tumor cells. These data may confirm the existence and importance of CSCs in ESCC progression and development. The clinical consequences of SALL4–SOX2 association suggest a possible functional interaction between these factors in regulation of ESCC maintenance and aggressiveness and introduce them as potentially interesting therapeutic targets for planning an appropriate onco-therapy strategy to reverse a broad spectrum of functional aberrations that promote ESCC development.
Notes
Acknowledgments
The authors gratefully acknowledge the colleagues from the departments of surgery and pathology at Omid Hospital and also the colleagues at the Division of Human Genetics for their help in gathering and preparing the tissue specimens.
Conflict of interest
The authors declare that they have no conflict of interests.
References
- 1.Frank NY, Schatton T, Frank MH. The therapeutic promise of the cancer stem cell concept. J Clin Invest. 2010;120(1):41–50.PubMedCentralPubMedCrossRefGoogle Scholar
- 2.He J, et al. Low-expression of microRNA-107 inhibits cell apoptosis in glioma by upregulation of SALL4. Int J Biochem Cell Biol. 2013;45(9):1962–73. Google Scholar
- 3.Yuri S, et al. Sall4 is essential for stabilization, but not for pluripotency, of embryonic stem cells by repressing aberrant trophectoderm gene expression. Stem Cells. 2009;27:796–805.PubMedCrossRefGoogle Scholar
- 4.Yang J, et al. A novel SALL4/OCT4 transcriptional feedback network for pluripotency of embryonic stem cells. PLoS One. 2010;5(5):e10766.Google Scholar
- 5.Yang J, Chai L, Fowles TC, Alipio Z, Xu D, Fink LM, Ward DC, Ma Y. Genome-wide analysis reveals Sall4 to be a major regulator of pluripotency in murine-embryonic stem cells. Proc Natl Acad Sci USA. 2008;105:19756–61.PubMedCentralPubMedCrossRefGoogle Scholar
- 6.Kobayashi D, et al. SALL4 is essential for cancer cell proliferation and is overexpressed at early clinical stages in breast cancer. Int J Oncol. 2011;38:933–9.PubMedGoogle Scholar
- 7.Forghanifard MM, et al. Role of SALL4 in the progression and metastasis of colorectal cancer. J Biomed Sci. 2013;20:6.PubMedCentralPubMedCrossRefGoogle Scholar
- 8.Oikawa T, et al. Sall4 regulates cell fate decision in fetal hepatic stem/progenitor cells. Gastroenterology. 2009;136(3):1000–11.PubMedCrossRefGoogle Scholar
- 9.Sinclair AH, Berta P, Palmer MS. A gene from the human sex determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990;346:240–4.PubMedCrossRefGoogle Scholar
- 10.Fong H, Hohenstein KA, Donovan PJ. Regulation of self-renewal and pluripotency by Sox2 in human embryonic stem cells. Stem Cells. 2008;26(8):1931–8.PubMedCrossRefGoogle Scholar
- 11.Patel M, Yang S. Advances in reprogramming somatic cells to induced pluripotent stem cells. Stem Cell Rev. 2010;6(3):367–80.PubMedCentralPubMedCrossRefGoogle Scholar
- 12.Laga AC, et al. Expression of the embryonic stem cell transcription factor SOX2 in human skin: relevance to melanocyte and Merkel cell biology. Am J Pathol. 2010;176(2):903–13.Google Scholar
- 13.Alonso MM, et al. Genetic and epigenetic modifications of Sox2 contribute to the invasive phenotype of malignant gliomas. PLoS One. 2011;6(11):e26740.PubMedCentralPubMedCrossRefGoogle Scholar
- 14.Li XL, et al. Expression of the SRY-related HMG box protein SOX2 in human gastric carcinoma. Int J Oncol. 2004;24(2):257–63.PubMedGoogle Scholar
- 15.Abd El-Maqsoud NM, Abd El-Rehim DM. Clinicopathologic implications of EpCAM and Sox2 expression in breast cancer. Clin Breast Cancer. 2014;14(1):e1–9.Google Scholar
- 16.Chen S, et al. SOX2 gene regulates the transcriptional network of oncogenes and affects tumorigenesis of human lung cancer cells. PLoS One. 2012;7(5):e36326.PubMedCentralPubMedCrossRefGoogle Scholar
- 17.Jia X, et al. SOX2 promotes tumorigenesis and increases the anti-apoptotic property of human prostate cancer cell. J Mol Cell Biol. 2011;3(4):230–8.PubMedCrossRefGoogle Scholar
- 18.Han X, et al. Silencing SOX2 induced mesenchymal–epithelial transition and its expression predicts liver and lymph node metastasis of CRC patients. PLoS One. 2012;7(8):e41335.PubMedCentralPubMedCrossRefGoogle Scholar
- 19.Girouard SD, et al. SOX2 contributes to melanoma cell invasion. Lab Invest. 2012;92(3):362–70.PubMedCrossRefGoogle Scholar
- 20.Sobin LH, Gospodarowicz MK, Wittekind C. TNM classification of malignant tumours. London: Wiley; 2011.Google Scholar
- 21.Rubie C, et al. Housekeeping gene variability in normal and cancerous colorectal, pancreatic, esophageal, gastric and hepatic tissues. Mol Cell Probes. 2005;19(2):101–9.PubMedCrossRefGoogle Scholar
- 22.Bass AJ, et al. SOX2 is an amplified lineage-survival oncogene in lung and esophageal squamous cell carcinomas. Nat Genet. 2009;41(11):1238–42. Google Scholar
- 23.Liu K, et al. Sox2 cooperates with inflammation-mediated Stat3 activation in the malignant transformation of foregut basal progenitor cells. Cell Stem Cell. 2013;12(3):304–15.PubMedCentralPubMedCrossRefGoogle Scholar
- 24.Ben-Porath I, et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet. 2008;40(5):499–507.PubMedCentralPubMedCrossRefGoogle Scholar
- 25.Mallanna SK, et al. Proteomic analysis of Sox2-associated proteins during early stages of mouse embryonic stem cell differentiation identifies Sox21 as a novel regulator of stem cell fate. Stem Cells. 2010;28(10):1715–27.PubMedCentralPubMedCrossRefGoogle Scholar
- 26.Hussenet T, Dali S, Exinger J, et al. SOX2 is an oncogene activated by recurrent 3q26.3 amplifications in human lung squamous cell carcinomas. PLoS One. 2010;5(1):e8960.PubMedCentralPubMedCrossRefGoogle Scholar
- 27.Bahl K, Saraya A, Sharma R. Increased levels of circulating and tissue mRNAs of Oct-4, Sox-2, Bmi-1 and Nanog is ESCC patients: potential tool for minimally invasive cancer diagnosis. Biomark Insights. 2012;7:27–37.PubMedCentralPubMedGoogle Scholar
- 28.Lu Y, et al. Evidence that SOX2 overexpression is oncogenic in the lung. PLoS One. 2010;5(6):e11022.PubMedCentralPubMedCrossRefGoogle Scholar
- 29.Chen Y, et al. The molecular mechanism governing the oncogenic potential of SOX2 in breast cancer. J Biol Chem. 2008;283(26):17969–78.PubMedCrossRefGoogle Scholar
- 30.Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126(4):663–76.PubMedCrossRefGoogle Scholar
- 31.Zhang J, et al. Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nat Cell Biol. 2006;8(10):1114–23.PubMedCrossRefGoogle Scholar
- 32.Kidder BL, Palmer S, Knott JG. SWI/SNF-Brg1 regulates self-renewal and occupies core pluripotency-related genes in embryonic stem cells. Stem Cells. 2009;27(2):317–28.PubMedCrossRefGoogle Scholar
- 33.He XT, Cao XF, Ji L. Association between Bmi1 and clinicopathological status of esophageal squamous cell carcinoma. World J Gastroenterol. 2009;15(19):2389–94.PubMedCentralPubMedCrossRefGoogle Scholar
- 34.Van Raay TJ, et al. Frizzled 5 signaling governs the neural potential of progenitors in the developing Xenopus retina. Neuron. 2005;46(1):23–36.PubMedCrossRefGoogle Scholar
- 35.Moghbeli M, et al. Association of PYGO2 and EGFR in esophageal squamous cell carcinoma. Med Oncol. 2013;30(2):516.PubMedCrossRefGoogle Scholar


