Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees
- 285 Downloads
- 1 Citations
Abstract
Aims
Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees.
Methods
Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2–8 and the exon–intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software.
Results
Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls.
Conclusion
Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.
Keywords
Iranian pedigrees Novel mutations WFS1 gene Wolfram syndromeIntroduction
Wolfram syndrome (WS, MIM 222300) is a rare progressive neurodegenerative disease which is primarily characterized by juvenile-onset diabetes mellitus (DM) and optic atrophy, typically within the first decade of life [1, 2]. Wolfram syndrome patients frequently present with other clinical manifestations such as diabetes insipidus, sensorineural deafness, acquired urinary tract abnormalities, ataxia, peripheral neuropathy, and psychiatric disorders, which typically appear during the second decade [2, 3, 4, 5]. Wolfram syndrome type 1 (WS-1), the most common form of WS, is associated with mutations in WFS1. A second type of WS, WS type 2 (WS-2), is associated with mutations in CISD2.
Wolfram syndrome, also known by the acronym DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), has an autosomal recessive pattern of inheritance [3, 5, 6]. The prevalence of WS is estimated to be as high as 1 in 770,000 in the UK and 1 in 100,000 in South America [3, 6].
The WS-1-associated gene, WFS1 (OMIM 606201), mapped on chromosome 4p16.1 [2, 4, 7], includes eight exons encompassing 33.4 Kb of genomic DNA. The first exon is non-coding, exons 2–8 are coding, and exon 8, the longest exon, is 2.6 Kb in length [1, 8]. WFS1 encodes an 890-amino acid protein, named wolframin, with an apparent molecular mass of 100 kDa. Wolframin is a tetrameric protein possessing nine putative helical transmembrane domains and is involved in the unfolded protein response [2, 6]. Northern blot analysis revealed WFS1 expression in heart, placenta, lung, and brain [9]. Wolframin plays a crucial role in maintaining homeostasis in the endoplasmic reticulum (ER) in pancreatic β cells [1, 5, 10]. Genetic studies of WS have demonstrated evidence for genetic heterogeneity [1, 6, 7]. Most WS patients carry loss of function mutations in WFS1 (OMIM 606201) [3, 11, 12].
In the present study, we analyzed WFS1 in 12 patients and their parents from 10 Iranian WS families. We aimed to examine the spectrum of WFS1 mutations in our population and determine likely genotype–phenotype correlations for WS. A second aim was to provide a feasible molecular genetic screening strategy to predict affected and unaffected siblings in WS families.
Materials and methods
Subjects
The Pedigree of Wolfram syndrome families: black Wolfram syndrome, Black/White Stripes square diabetes mellitus
The clinical features of WS patients
| Family no. | Patient no. | Sex (M/F) | Age (years) | Consanguinity | Age at diagnosis (years) | Neurological abnormities | Other complication | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| DM | OA | DI | D | UTA | |||||||
| F1 | P1 | M | 19 | +FD | 6 | 6 | 4 | 7 | + | – | – |
| F1 | P2 | M | 14 | +FD | 7 | 8 | 4 | 14 | NB | ||
| F2 | P3 | F | 11 | +FD | 5.5 | 6 | 2 | – | – | Cataract | |
| F2 | P4 | M | 12 | +FD | 7 | 2 | |||||
| F3 | P5 | M | 12 | +FD | 4 | 5 | 4 | 9 | _ | – | – |
| F4 | P6 | M | 25 | +FD | 7 | 6 | 5 | 10 | 12 | 14 | Cataract |
| F5 | P7 | M | 16 | +FD | 6 | 7 | 3 | + | + | Cataract | |
| Renal failure | |||||||||||
| F6 | P8 | F | 15 | +FD | 3 | 10 | 6 | 11 | 8, NB | – | – |
| F7 | P9 | F | 10 | ||||||||
| F8 | P10 | F | 10 | 7 | – | 7 | – | _ | – | – | |
| F9 | P11 | F | 9 | +FD | 6 | 8, NB | |||||
| F10 | P12 | M | 7 | 5 | – | 5 | NB | – | – | ||
DNA extraction
Three milliliter blood samples from all patients and their available parents were collected in tubes containing EDTA. Genomic DNA was extracted from peripheral blood samples using a standard salting-out method (Ref method).
PCR amplification and sequencing of WFS1
Exons 2–8 and the intron–exon boundaries of WFS1 were amplified with a combination of 13 primer pairs as reported elsewhere (Ref primer). Because it seemed likely that most mutations would be located within exon 8, which represents 68 % of the WFS1 coding sequence, we first screened exon 8 for mutations in all subjects. Thereafter, exons 2–7 were sequenced only when no mutations were found in exon 8. After electrophoresis, the PCR products were isolated with a DNA gel extraction kit (Invitek, Berlin, Germany) and bidirectionally sequenced on an ABI 3730 XL automated DNA sequencer. Finally, the sequencing results were aligned with a reference sequence in NCBI using the Sequencher sequence alignment software (version 4.10.1).
Amplification refractory mutation system (ARMS)
Primer sequences for ARMS-PCR
| Forward control | TTCCCACGTACCATCTTTCC |
| Reverse control | CACATCCAGGTTGGGCTC |
| Forward mutant | CTTCATCGTCAGCAACCGCAT |
| Forward normal | CTTCATCGTCAGCAACCTCAC |
Comparative in silico analysis of 1010C > T among different vertebrates
A comparative genomic analysis, by aligning nucleotide sequences of different vertebrate species, was performed to show that the site of identified missense mutation c.1010C > T is conserved during evolution. The in silico analysis was carried out using CLC Main Workbench software (Denmark).
Results
The novel mutation c.1379–1381del/p.THR461del
In-frame 3-base pair (bp) deletion
The novel mutation, c.1097-1107dup (11 bp)/p.A370RfsX76
The novel missense mutation, c.1010C > T/p.T337I
Comparative genomic analysis of identified missense mutation c.1010C > T in different vertebrate species
Discussion
Wolfram syndrome-1 is a potentially destructive autosomal recessive neurodegenerative disease caused by mutations in WFS1 [10, 14, 15]. The present study identified four novel mutations in 12 Iranian WS patients. Patients usually display with non-autoimmune-type 1 DM followed by optic atrophy in the first decade [9, 10, 16]. In our study, DM was diagnosed at 5.54 ± 0.37 years of age. WFS1 encodes wolframin, which is located in the ER membrane. When mutations sufficiently decrease wolframin’s activity, an ER stress signaling pathway is initiated that results in apoptosis. The death of beta cells in the pancreas causes DM in WS individuals, which is clearly different from autoimmune-type diabetes [13, 14, 17, 18]. Molecular genetic analysis is critical in monogenic diabetes in order to diagnose WS, so adequate treatment can be initiated [19, 20]. Few mutations have been reported in patients from Iran; in addition, no data are available concerning the prevalence of WFS1 and cisd2 mutations or carrier frequency in Iran. The frameshift alteration, c.2177_2178insTCTT C (or c.2173_2177dup TCTTC) in exon 8, was reported in a family of Persian origin [15]. One of the most important reasons for this study on the population is because the genetic background of this area consists of different ethnic populations such as Kurd, Turk, and Fars, who practice high rates of consanguineous marriage. We screened 12 WS patients from unrelated families. The most frequent mutation in the Iranian pedigrees in our study was a frameshift in exon 8, found in five patients. Two mutations were identified in four patients; these were a frameshift deletion, c.1230_1233delCTCT/p.Val412SerfsX29, and c.1234_1237delGTCT/p.Val412SerX29. These mutations have been previously reported [20, 21, 22]. We found novel variations in five families; the region of exon 8 containing these mutations may be a mutation hot spot. One mutation was identified in five families. Patients with this mutation suffered from neurogenic bladders at early ages. One patient in our study was first diagnosed with urinary tract abnormalities [13]. Optic atrophy, in which the optic nerve wastes away due to cell loss, occurs in 60 % of WS patients and is progressive. Wolfram syndrome mutations could affect the survival of retinal ganglion cells (RGC’s) and optic nerve glial cells. Wolframin is abundant in human RGC cell bodies [18, 23, 24]. Histochemical analysis of wolframin RNA in mice brains found that mutations in wfs1 cause neuronal dysfunctions of the supraoptic nucleus and in magnocellular neurons of the paraventricular hypothalamic nucleus. These data suggest that in the brains of WS patients, loss of vasopressin-producing neurons occurs in the supraoptic nucleus and vasopressin precursor processing does not work [8, 9, 10, 14]. In our study, only two patients from one family were diabetes insipidus (DI) negative; in addition, no mutations were detected in two families (F2 and F5). The only atypical phenotype identified in patients from these families was DI in F2. We found no WFS1 mutations in these patients. It has been suggested that mutations in WFS1 may be present in non-exon regions such as the promoter or intronic regions or in cisd2, located on chromosome 4q22, causing WS-2 (MIM 604928) [25].
Conclusion
Our study increases the spectrum of WFS1 mutations and supports the role of WFS1 in susceptibility to WS. Nine of the 12 WS patients in our study had WFS1 mutations. Most of the mutations leading to WS, such as frameshift insertion and deletion mutations, lead to a prematurely truncated wolframin protein. We hope these findings will open new horizons to future molecular investigations that may aid in the prevention and treatment of this devastating disease.
Notes
Acknowledgments
We gratefully acknowledge the contribution of the scientific collaborators of Human Genetics Department of Bu-Ali Research Institute of Mashhad University of Medical Sciences.
Authors’ contributions
MGh and SH carried out the molecular genetic studies and drafted the manuscript. FFG participated in molecular studied. NGh and RV contributed in clinical diagnosis of samples for study. MRA and RV designed and supervised the study. MMF revised the manuscript. All authors read and approved the final manuscript.
Funding
This study was supported by grants to RV from Mashhad University of Medical Sciences (No. 86526).
Compliance with ethical standards
Conflict of interest
The authors declare no potential conflicts of interest.
Ethical standard
All procedures were in accordance with the ethical standards of institutional research committee and with the Helsinky declaration.
Human and animal rights
All procedures performed in studies involving human participants were in accordance with the Ethical Standards of the Mashhad University of Medical Sciences and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.
Informed consent
Informed consent was obtained from all individual participants included in the study.
References
- 1.Barrett T, Bundey S, Macleod A (1995) Neurodegeneration and diabetes: UK nationwide study of Wolfram (DIDMOAD) syndrome. Lancet 346(8988):1458–1463CrossRefPubMedGoogle Scholar
- 2.Hofmann S et al (1997) Wolfram (DIDMOAD) syndrome and Leber hereditary optic neuropathy (LHON) are associated with distinct mitochondrial DNA haplotypes. Genomics 39(1):8–18CrossRefPubMedGoogle Scholar
- 3.Scolding NJ et al (1996) Wolfram syndrome: hereditary diabetes mellitus with brainstem and optic atrophy. Ann Neurol 39(3):352–360CrossRefPubMedGoogle Scholar
- 4.Gómez-Zaera M et al (2001) Presence of a major WFS1 mutation in Spanish Wolfram syndrome pedigrees. Mol Genet Metab 72(1):72–81CrossRefPubMedGoogle Scholar
- 5.Inoue H et al (1998) A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nat Genet 20(2):143–148CrossRefPubMedGoogle Scholar
- 6.Tessa A et al (2001) Identification of novel WFS1 mutations in Italian children with Wolfram syndrome. Hum Mutat 17(4):348–349CrossRefPubMedGoogle Scholar
- 7.Takeda K et al (2001) WFS1 (Wolfram syndrome 1) gene product: predominant subcellular localization to endoplasmic reticulum in cultured cells and neuronal expression in rat brain. Hum Mol Genet 10(5):477–484CrossRefPubMedGoogle Scholar
- 8.Urano F (2014) Diabetes: targeting endoplasmic reticulum to combat juvenile diabetes. Nat Rev Endocrinol 10(3):129–130CrossRefPubMedPubMedCentralGoogle Scholar
- 9.Berry V et al (2013) Wolfram gene (WFS1) mutation causes autosomal dominant congenital nuclear cataract in humans. Eur J Hum Genet 21(12):1356–1360CrossRefPubMedPubMedCentralGoogle Scholar
- 10.Rigoli L, Lombardo F, Di Bella C (2011) Wolfram syndrome and WFS1 gene. Clin Genet 79(2):103–117CrossRefPubMedGoogle Scholar
- 11.Hardy C et al (1999) Clinical and molecular genetic analysis of 19 Wolfram syndrome kindreds demonstrating a wide spectrum of mutations in WFS1. Am J Hum Genet 65(5):1279–1290CrossRefPubMedPubMedCentralGoogle Scholar
- 12.Collier DA et al (1996) Linkage of Wolfram syndrome to chromosome 4p16. 1 and evidence for heterogeneity. Am J Hum Genet 59(4):855PubMedPubMedCentralGoogle Scholar
- 13.Bucca BC, Klingensmith G, Bennett JL (2011) Wolfram syndrome: a rare optic neuropathy in youth with type 1 diabetes. Optom Vis Sci 88(11):E1383–E1390CrossRefPubMedGoogle Scholar
- 14.Rigoli L, Di Bella C (2012) Wolfram syndrome 1 and Wolfram syndrome 2. Curr Opin Pediatr 24(4):512–517PubMedGoogle Scholar
- 15.Sobhani M et al (2013) Molecular characterization of WFS1 in an Iranian family with Wolfram syndrome reveals a novel frameshift mutation associated with early symptoms. Gene 528(2):309–313CrossRefPubMedGoogle Scholar
- 16.Yuca SA et al (2012) Rapidly progressive renal disease as part of Wolfram syndrome in a large inbred Turkish family due to a novel WFS1 mutation (p. Leu511Pro). Eur J Med Genet 55(1):37–42CrossRefPubMedGoogle Scholar
- 17.Sobhani M et al (2014) Significant expressivity of Wolfram syndrome: phenotypic assessment of two known and one novel mutation in the WFS1 gene in three Iranian families. Mol Biol Rep 41(11):7499–7505CrossRefPubMedGoogle Scholar
- 18.Aloi C et al (2012) Wolfram syndrome: new mutations, different phenotype. PLoS One 7(1):e29150CrossRefPubMedPubMedCentralGoogle Scholar
- 19.Piccinno E et al (2014) Novel homozygous mutation in exon 5 of WFS1 gene in an Apulian family with mild phenotypic expression of Wolfram syndrome. Clin Genet 86(2):197–198CrossRefPubMedGoogle Scholar
- 20.Bonnycastle LL et al (2013) Autosomal dominant diabetes arising from a Wolfram syndrome 1 mutation. Diabetes 62(11):3943–3950CrossRefPubMedPubMedCentralGoogle Scholar
- 21.Gasparin MRR et al (2009) Identification of novel mutations of the WFS1 gene in Brazilian patients with Wolfram syndrome. Eur J Endocrinol 160(2):309–316CrossRefPubMedGoogle Scholar
- 22.Hansen L et al (2005) Mutation analysis of the WFS1 gene in seven Danish Wolfram syndrome families; four new mutations identified. Eur J Hum Genet 13(12):1275–1284CrossRefPubMedGoogle Scholar
- 23.Elli FM et al (2012) A new structural rearrangement associated to Wolfram syndrome in a child with a partial phenotype. Gene 509(1):168–172CrossRefPubMedGoogle Scholar
- 24.Pitt K et al (2011) A single base-pair deletion in the WFS1 gene causes Wolfram syndrome. J Pediatr Endocrinol Metab 24(5–6):389–391PubMedGoogle Scholar
- 25.Amr S et al (2007) A homozygous mutation in a novel zinc-finger protein, ERIS, is responsible for Wolfram syndrome 2. Am J Hum Genet 81(4):673–683CrossRefPubMedPubMedCentralGoogle Scholar