Download PDF

Molecular detection of Leishmania species in northeast of Iran

  • Mohammad Javad Namazi
  • Azar Balooti Dehkordi
  • Faezeh Haghighi
  • Mohammad Mohammadzadeh
  • Mehdi Zarean
  • Morteza Haghighi Hasanabad
Original Article
First Online:
Received:
Accepted:
  • 11 Downloads

Abstract

Two known types of cutaneous leishmaniasis (CL) including zoonotic CL due to Leishmania major and anthroponotic CL due to Leishmania tropica are prevalent in 14 of 22 countries located in the Eastern Mediterranean region including Iran. According to existing data, CL is endemic in Sabzevar City (northeast of Iran) and, because of the climatic conditions in this semi-desert region, is suitable for living vector/reservoir hosts of infection. The aim of our study was to identify the recent status of CL causative species in rural areas of Sabzevar County. Suspected patients of CL who were referred to health centers in suburban areas of Sabzevar and confirmed via microscopic observation of amastigotes were included in the study. Molecular identification of Leishmania species was done via nested PCR assay, based on amplification of kinetoplast minicircle fragments of L. major and L. tropica. In total, 153 patients including 89 males and 64 females were enrolled in this study. A high infection rate was reported in the autumn season (with a peak in October). Our findings revealed that L. major is responsible for 100% of infections. In addition, there was no association between CL and risk factors after statistical analysis. It seems that the infection pattern of CL is changing predominantly to L. major in most regions of Iran, which may be due to environmental changes, or ecological amendment and their effects on (vector/reservoir) host distribution in rural parts. Finally, controlling programs as well as promotion in public health systems should be considered in this area.

Keywords

Cutaneous leishmaniasis Leishmania major Leishmania tropica Nested PCR 
Download article PDF

Introduction

Leishmaniasis is an obligate intracellular protozoan parasitic disease caused by Leishmania species (Mahmoudvand et al. 2011). Cutaneous leishmaniasis (CL) is the most common form of leishmaniasis and known as a public health and social problem in all tropical and subtropical areas of the world (Murray et al. 2015; Kavarizadeh et al. 2017).

The distribution of this disease is very tightly linked to geographical regions so that villages even 15 miles apart can have very different rates of cutaneous leishmaniasis (Mathers et al. 2007). An estimated 0.7 million to 1.2 million new cases occur worldwide annually and over two thirds of new cases occur in 10 countries, namely Afghanistan, Algeria, Brazil, Colombia, Syria, Costa Rica, Ethiopia, Peru, Sudan, and Iran (Alvar et al. 2012).

According to the reports of the World Health Organization (WHO), the number of reported CL cases increased from 12,727 in 2000 to more than 21,148 in 2010 in Iran. In addition, the incidence rate of CL was 2.68 cases per 10,000 inhabitants in endemic areas of Iran. This report shows CL disease prevalence is increasing in Iran (Postigo 2016).

There are two forms of CL including anthroponotic cutaneous leishmaniasis (ACL) due to Leishmania tropica and zoonotic cutaneous leishmaniasis (ZCL) caused by Leishmania major in Iran (Mirahmadi et al. 2016; Vazirianzadeh et al. 2013). The different species are morphologically indistinguishable and sometimes cause similar clinical signs. Since treatment regimen is different in the two forms of CL, thus accurate identification of Leishmania species is essential for the control and prevention of the disease (Sharifi et al. 2012; Schwarz et al. 2015).

Direct microscopic examinations and culture method are the simplest means of diagnosing CL, but they do not discriminate the organism in the species level (Asgari Nezhad et al. 2012; Gillespie et al. 2016). Therefore, differentiation of Leishmania species requires diagnostic techniques with reliable sensitivity and specificity like molecular methods (Pouresmaeliyan et al. 2011; Shirian et al. 2014). For the genetic diversity in leishmania, the methods commonly used are Mini Exon RFLP and ITS RFLP and markers of microsatellite. The conserved area of Leishmania kinetoplast DNA (kDNA) minicircles has been used as a particular target for PCR assays. The kDNA is arranged at the base of the flagellum and contains a huge number of minicircles and many maxicircles. The minicircles, which encode for guide RNAs needed for editing the mRNA from maxicircles, have now been reported to be within about 10,000–20,000 copies per parasite (Shlomai 2004; Zarean et al. 2017).

In order to accelerate progress towards the strategies of WHO for leishmaniasis prevention, control, and monitoring programs in highly endemic regions, we aimed to determine the recent status of causative CL species in rural areas of Sabzevar County, northeast of Iran.

Materials and methods

Suspected patients of CL who were referred to local health centers in suburban areas of Sabzevar City during the study period were defined as the target population. Slide samples from scars and ulcers of patients were obtained by experienced staffs of laboratories and evaluated for leishmania amastigotes via direct microscopic examination. Giemsa-stained slides were sent to the research center laboratory in Sabzevar University of Medical Sciences and prepared for molecular tests. Briefly, slide surfaces were scratched with a scalpel and precipitated in a 1.5-ml microtube through ethanol wash (Hosseininasab et al. 2014; Pour et al. 2011).

The Ethical Committee of Sabzevar University of Medical Sciences approved this project. Consent forms were signed by participants and a questionnaire form fulfilled by each patient in this study.

DNA extraction

DNA was extracted by DNP extraction kit (Cinnagen Ltd. Co., Iran) according to the manufacturer’s instruction and eluted in 50 μl of TE buffer.

PCR

Variable regions of minicircle fragments of kinetoplast DNA (kDNA) were amplified by nested PCR assay using two sets of previously described primers (Table 1) (Noyes et al. 1998; Zarean et al. 2015). First round of nested PCR was performed in a final volume of 25 μl (12 μl of Master mix PCR solution 1X) (Ampliqon, Denmark), 1 μl of primers (20 pmol) CSB1XR and CSB2XF, 3 μl DNA (50 ng), and 8 μl deionized distilled water, over 30 cycles including denaturation at 94 °C for 30 s, annealing at 55 °C for 60 s, and extension at 72 °C for 90 s, followed by a final extension step at 72 °C for 8 min (Bio-Rad thermocycler). One microliter of the first-round product diluted in 9 μl of distilled water was used as template for the second-round PCR in a total volume of 25 μl under the same conditions as those for the first round, except with primers 13Z and LiR. A negative control (water) and two positive controls [L. tropica (MHOM/Sudan 158/OD strain) and L. major (MRHO/IR/75/ER strain)] yielding 750- and 560-bp fragments, respectively, were used in each round of PCR. Finally, PCR products were analyzed on 1.5% agarose gel (Roche, Germany) through 0.5% TBE buffer (Sigma-Aldrich) and were visualized by DNA safe stain (Cinnagen Ltd. Co., Iran) under a UV transiluminator.
Table 1

Primer sequences used for amplification of variable minicircles kDNA

Primers

Primer sequence (5′–3′)

External

CSB1XR

CSB2XF

CGAGTAGCAGAAACTCCCGTTCA

ATTTTTCGCGATTTTCGCAGAACG

Internal

13Z

LiR

ACTGGGGGTTGGTGTAAAATAG

TCGCAGAACGCCCCT

Data analysis

Statistical analyses were estimated using SPSS for windows (version 20. Chicago, Ltd., USA). Chi-square test with the level of significance defined as P < 0.05 and common odds ratio (95% CI) were used for possible association of variables.

Results

One hundred fifty-three patients diagnosed with CL were enrolled in this study. In total, 89 (58.2%) out of 153 cases were male and 64 (41.8%) were female. Patient’s ages ranged from 3 to 88 years and the highest rate of infection was recorded in the 20–30 years age group (23.5%). Figure 2 shows the infection rate of participants in different age groups in this study. The maximum number of CL was reported in autumn (with a peak in October) and there was no infection in winter.

Thirty-eight percent of infected people had a single lesion and multiple lesions were seen on 33.3% of patients. Furthermore, the most common lesion sites were observed on patients’ hand and arm (59.4%) (Table 2).
Table 2

Characteristics of features of patients with cutaneous leishmaniasis in Sabzevar County, northeast of Iran

Feature

Classification

No. of cases

Percent

Location of lesions

Hand

53

35.1

Arm

37

24.3

Foot

32

21

Neck

17

11

Face

9

6

Others

5

2.6

Total

153

100

Gender

Male

89

58.2

Female

64

41.8

Total

153

100

Age

< 10

15

9.5

10–19

33

22

20–29

35

23.5

30–39

22

14.5

40–49

15

9.5

50–59

18

12

60–69

4

2.5

70–79

6

3.5

> 80

5

3

Total

153

100

Our findings revealed that all patients in this study are suffering from zoonotic cutaneous leishmaniasis form and L. major is responsible for 100% of infection in this geographical region (Fig. 1).
Fig. 1

Agarose gel electrophoresis of Leishmania isolates. Lane 1: DNA size marker 100 bp. Lane 2: negative control. Lane 3: L. tropica (positive control 750 bp). Lane 4: L. major (positive control 560 bp). Lane 5: L. major isolates obtained from skin lesions of the patients in Sabzevar, northeast of Iran

Fig. 2

Infection rates of patients based on age groups

In addition, there were no statistically significant differences between CL infection and related risk factors in patients.

Discussion

In this study, L. major was the only strain isolated from patients living in the suburban area of Sabzevar. This finding is in agreement with that of a previous study conducted in this region which reported L. major as the main cause of CL (73%) in rural areas (Mohajery et al. 2010). Likewise in our results, L. major is reported as the only pathogen isolated from patients suffering from CL in different areas of Iran like Varzaneh, Mehran, Gonbad-e-Qabus, Esfahan, and Qom (Arjmand et al. 2014; Feiz Haddad et al. 2016; Mesgarian et al. 2010; Mohammadi et al. 2011; Nateghi Rostami et al. 2013). Moreover, L. major was responsible as the main cause of infection in some other studies conducted in Tehran (64%), Shiraz (90.7%), Khuzestan (94.5%), and Kashan (92.1%) (Farahmand et al. 2011; Izadi et al. 2016; Maraghi et al. 2013; Shiee et al. 2012). Based on these findings, it seems that a changing profile of Leishmania species is happening in different areas of Iran (Zarean et al. 2017), which may be due to implications on treatment and control strategies for ACL like patient monitoring systems, as well as combating with another reservoir host (dogs), and consequently breaking the cycle of transmission.

Our work indicated that the most highly infected age groups are 21–30 years and 10–19 years (23.5 and 22%, consecutively). Based on data published from Borojerd, Ilam, and Shoushtar, individuals between 21 to 30 years are the most highly infected age group (Ahmadi et al. 2013; Kassiri et al. 2012, 2014). In addition, some other studies imply that CL is more prevalent in people younger than 20 years old (Azizi et al. 2013; Khosravi et al. 2013). Generally, it could be related to pre-exposure to sand flies and infection in people > 30 years old.

In the present study, single lesions were recorded as more common than double or multiple lesions and uncovered parts of patients’ bodies including the hand and arm, legs, neck, and face were documented as the most bitten sites, respectively. These results are consistent with those of several studies in other endemic areas of ZCL in Iran (Kermanjani et al. 2016; Tolouei et al. 2014). It seems that this model is mostly related to single biting habits of sand flies and the fact that they cannot drink the blood over clothes.

Based on data reported from other cities like Kashan and Kermanshah, a high incidence rate of infection happens in the last summer and first autumn annually (Doroodgar et al. 2012; Hamzavi and Khademi 2015). Accordingly, almost 50% of infections in this study were documented just in October. Except weather condition, possibly the most likely reason of that is occupational contact (as a farmer) with sand flies.

Conclusion

Leishmania infection is still a main problem in semi-desert areas and the present study shows that L. major is the main causative agent of CL in our region (Sabzevar) which is located northeast of Iran. Furthermore, in view of the fact that different species of Leishmania require different treatment regimens, molecular assays like nested PCR are precise tools for diagnosing the epidemiological pattern of this disease. Finally, we suggest further studies for identification of vector/reservoir hosts and their role in Leishmania infection in each endemic area.

Notes

Acknowledgements

The collection of the samples was made by the personnel of the local health centers around Sabzevar County including Neghab, Jovein, and Hokmabad.

Authors’ contributions

M.J. Namazi conceived and designed the study; A. Balooti Dehkordi collaborated in the preparation of samples; F. Haghighi drafted the manuscript; M. Mohammadzadeh contributed to the design of the study and was involved in all steps of the experiment; M. Zarean critically revised the manuscript and approved the final study; M. Haghighi Hasanabad interpreted data and PCR performance. All authors have read and approved the final manuscript.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Ethical statement

This study was reviewed and approved by the Ethics Committees of Sabzevar University of Medical Sciences, Sabzevar, Iran. Consent forms were signed by participants and a questionnaire form fulfilled by each patient in this study.

References

  1. Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, Boer M, the WHO Leishmaniasis Control Team (2012) Leishmaniasis worldwide and global estimates of its incidence. PLoS One 7(5):e35671CrossRefPubMedPubMedCentralGoogle Scholar
  2. Arjmand R, Saberi S, Tolouei S, Chizari Z, Nobari RF, Fard SS et al (2014) Identification of Leishmania isolates from Varzaneh city, Isfahan province, Iran using nested polymerase chain reaction method. Adv Biomed Res 3:167CrossRefPubMedPubMedCentralGoogle Scholar
  3. Asgari Nezhad H, Mirzaie M, Sharifi I, Zarean M, Norouzi M (2012) The prevalence of cutaneous leishmaniasis in school children in southwestern Iran, 2009. Comp Clin Pathol 21(5):1065–1069CrossRefGoogle Scholar
  4. Azizi K, Badzohreh A, Sarkari B, Fakoorziba MR, Kalantari M, Moemenbellah-Fard MD, Ali-Akbarpour M (2013) Nested polymerase chain reaction and sequence-based detection of leishmania infection of sand flies in recently emerged endemic focus of zoonotic cutaneous leishmaniasis, southern Iran. Iran J Med Sci 38(2 Suppl):156–162PubMedPubMedCentralGoogle Scholar
  5. Doroodgar A, Sayyah M, Doroodgar M, Mahbobi S, Nemetian M, Rafizadeh S, Rassi Y (2012) Progressive increasing of cutaneous leishmaniasis in Kashan District, central of Iran. Asian Pac J Trop Dis 2(4):260–263CrossRefGoogle Scholar
  6. Farahmand M, Nahrevanian H, Shirazi HA, Naeimi S, Farzanehnejad Z (2011) An overview of a diagnostic and epidemiologic reappraisal of cutaneous leishmaniasis in Iran. Braz J Infect Dis 15(1):17–21CrossRefPubMedGoogle Scholar
  7. Feiz Haddad MH, Ghasemi E, Maraghi S, Tavala M (2016) Identification of Leishmania species isolated from human cutaneous leishmaniasis in Mehran, western Iran using nested PCR. Iran J Parasitol 11(1):65–72PubMedPubMedCentralGoogle Scholar
  8. Gillespie PM, Beaumier CM, Strych U, Hayward T, Hotez PJ, Bottazzi ME (2016) Status of vaccine research and development of vaccines for leishmaniasis. Vaccine 34(26):2992–2995CrossRefPubMedGoogle Scholar
  9. Hamzavi Y, Khademi N (2015) Trend of cutaneous leishmaniasis in Kermanshah province, west of Iran from 1990 to 2012. Iran J Parasitol 10(1):78–86PubMedPubMedCentralGoogle Scholar
  10. Hosseininasab A, Sharifi I, Mohammad Hossein D, Zarean M, Dadkhah M (2014) Causes of pediatric visceral leishmaniasis in southeastern Iran. Iran J Parasitol 9(4):584–587PubMedPubMedCentralGoogle Scholar
  11. Izadi S, Mirhendi H, Jalalizand N, Khodadadi H, Mohebali M, Nekoeian S, Jamshidi A, Ghatee MA (2016) Molecular epidemiological survey of cutaneous leishmaniasis in two highly endemic metropolises of Iran, application of FTA cards for DNA extraction from Giemsa-stained slides. Jundishapur J Microbiol 9(2):e32885CrossRefPubMedPubMedCentralGoogle Scholar
  12. Kassiri H, Sharifinia N, Jalilian M, Shemshad K (2012) Epidemiological aspects of cutaneous leishmaniasis in Ilam province, west of Iran (2000–2007). Asian Pac J Trop Dis 2:S382–S3S6CrossRefGoogle Scholar
  13. Kassiri H, Kassiri A, Lotfi M, Farajifard P, Kassiri E (2014) Laboratory diagnosis, clinical manifestations, epidemiological situation and public health importance of cutaneous leishmaniasis in Shushtar County, southwestern Iran. J Acute Dis 3(2):93–98CrossRefGoogle Scholar
  14. Kavarizadeh F, Khademvatan S, Vazirianzadeh B, Feizhaddad MH, Zarean M (2017) Molecular characterization of Leishmania parasites isolated from sandflies species of a zoonotic cutaneous leishmaniasis in Musiyan south west Iran. J Parasit Dis 41(1):274–281CrossRefPubMedGoogle Scholar
  15. Kermanjani A, Akhlaghi L, Oormazdi H, Hadighi R (2016) Isolation and identification of cutaneous leishmaniasis species by PCR–RFLP in Ilam province, the west of Iran. J Parasitic Dis 1–5Google Scholar
  16. Khosravi A, Sharifi I, Dortaj E, Aghaei Afshar A, Mostafavi M (2013) The present status of cutaneous leishmaniasis in a recently emerged focus in south-west of Kerman Province, Iran. Iran J Public Health 42(2):182–187PubMedPubMedCentralGoogle Scholar
  17. Mahmoudvand H, Mohebali M, Sharifi I, Keshavarz H, Hajjaran H, Akhoundi B, Jahanbakhsh S, Zarean M, Javadi A (2011) Epidemiological aspects of visceral leishmaniasis in Baft district, Kerman Province, southeast of Iran. Iran J Parasitol 6(1):1–11PubMedPubMedCentralGoogle Scholar
  18. Maraghi S, Mardanshah O, Rafiei A, Samarbafzadeh A, Vazirianzadeh B (2013) Identification of cutaneous leishmaniasis agents in four geographical regions of Khuzestan Province using nested PCR. Jundishapur J Microbiol 6(4)Google Scholar
  19. Mathers CD, Ezzati M, Lopez AD (2007) Measuring the burden of neglected L. tropica diseases: the global burden of disease framework. PLoS Negl Trop Dis 1(2):e114CrossRefPubMedPubMedCentralGoogle Scholar
  20. Mesgarian F, Rahbarian N, Mahmoudi Rad M, Hajaran H, Shahbaz F, Mesgarian Z et al (2010) Identification of Leishmania species isolated from human cutaneous Leishmaniasis in Gonbad-e-Qabus city using a PCR method during 2006–2007. Tehran Univ Med J 68(4):250–256Google Scholar
  21. Mirahmadi H, Salimi Khorashad A, Sohrabnahad A, Heydarian P, Bizhani N (2016) Species identification and molecular typing of Leishmania spp. using targeting HSP70 gene in suspected patients of cutaneous Leishmaniasis from Sistan and Baluchestan Province, Southeast Iran. Iran J Parasitol 11(4):489–498PubMedPubMedCentralGoogle Scholar
  22. Mohajery M, Shamsian SA, Rezaee AR, Hassanpoor K, Shakeri MT, Farnoosh GH (2010) Evaluation of molecular epidemiology of cutaneous leishmaniasis in Sabzevar. J Mashhad Univ Med Sci 53:138–144Google Scholar
  23. Mohammadi F, Narimani M, Nekoian S, Shirani Bidabadi L, Mohammadi F, Hosseini M et al (2011) Identification and isolation of the cause of cutaneous leishmaniasis in Is-fahan using ITS-PCR. J Isfahan Med Sch 30:1–7Google Scholar
  24. Murray CJ, Barber RM, Foreman KJ, Abbasoglu Ozgoren A, Abd-Allah F, Abera SF et al (2015) Global, regional, and national disability-adjusted life years (DALYs) for 306 diseases and injuries and healthy life expectancy (HALE) for 188 countries, 1990–2013: quantifying the epidemiological transition. Lancet 386(10009):2145–2191CrossRefPubMedGoogle Scholar
  25. Nateghi Rostami M, Saghafipour A, Vesali E (2013) A newly emerged cutaneous leishmaniasis focus in central Iran. Int J Infect Dis 17(12):e1198–e1206CrossRefPubMedGoogle Scholar
  26. Noyes HA, Reyburn H, Bailey JW, Smith D (1998) A nested-PCR-based schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of the epidemiology of Leishmania tropica in Pakistan. J Clin Microbiol 36(10):2877–2881PubMedPubMedCentralGoogle Scholar
  27. Postigo J (2016) Leishmaniasis in high-burden countries: an epidemiological update based on data reported in 2016. Weekly epidemiological record (http://who.int/wer/2016/wer9122)
  28. Pour R, Sharifi I, Kazemi B, Zarean M (2011) Identification of nonresponsive isolates to glucantime in patients with cutaneous leishmanaisis in Bam. J Kerman Univ Med Sci 18(2):123–133Google Scholar
  29. Pouresmaeliyan S, Mirzaei M, Sharifi I, Zarean M (2011) The prevalence of cutaneous leishmaniasis in the city and suburb of Mohammadabad, Jiroft District and identification of parasite species by nested-PCR, 2008. J Kerman Univ Med Sci 18(3):218–227Google Scholar
  30. Schwarz NG, Loderstaedt U, Hahn A, Hinz R, Zautner AE, Eibach D et al (2015) Microbiological laboratory diagnostics of neglected zoonotic diseases (NZDs). Acta Trop 15(7):75–78Google Scholar
  31. Sharifi F, Sharifi I, Zarean M, Hakimi Parizi M, Aflatoonian MR, Fasihi Harandi M et al (2012) Spatial distribution and molecular identification of Leishmania species from endemic foci of south-eastern Iran. Iran J Parasitol 7(1):45–52PubMedPubMedCentralGoogle Scholar
  32. Shiee MR, Hajjaran H, Mohebali M, Doroodgar A, Saadat MH, Teimouri A et al (2012) A molecular and parasitological survey on cutaneous leishmaniasis patients from historical city of Kashan in Isfahan province, center of Iran. Asian Pac J Trop Dis 2(6):421–425CrossRefGoogle Scholar
  33. Shirian S, Oryan A, Hatam GR, Panahi S, Daneshbod Y (2014) Comparison of conventional, molecular, and immunohistochemical methods in diagnosis of typical and atypical cutaneous leishmaniasis. Arch Pathol Lab Med 138(2):235–240CrossRefPubMedGoogle Scholar
  34. Shlomai J (2004) The structure and replication of kinetoplast DNA. Curr Mol Med 4:623–647CrossRefPubMedGoogle Scholar
  35. Tolouei S, Hejazi SH, Ghaedi K, Hasheminia SJ (2014) Identification of leishmania isolates from healing and nonhealing cutaneous leishmaniasis patients using internal transcribed spacer region PCR. Jundishapur J Microbiol 7(4):e9529CrossRefPubMedPubMedCentralGoogle Scholar
  36. Vazirianzadeh B, Saki J, Jahanifard E, Zarean M, Amraee K, Navid Pour S (2013) Isolation and identification of Leishmania species from sandflies and rodents collected from Roffaye District, Khuzestan Province, southwest of Iran. Jundishapur J Microbiol 6(6):e10025CrossRefGoogle Scholar
  37. Zarean M, Maraghi S, Hajjaran H, Mohebali M, Feiz-Hadad MH, Assarehzadegan MA (2015) Comparison of proteome profiling of two sensitive and resistant field Iranian isolates of Leishmania major to Glucantime® by 2-dimensional electrophoresis. Iran J Parasitol 10(1):19–29PubMedPubMedCentralGoogle Scholar
  38. Zarean M, Maraghi SH, Hajjaran H, Mohebali M, Feiz-Haddad MH, Assarehzadegan MA (2017) Correlation between clinical responses with the drug-susceptibility of parasites in Iranian cutaneous leishmaniasis caused by Leishmania major. Trop Biomed 34(2):338–345Google Scholar

Copyright information

© Springer-Verlag London Ltd., part of Springer Nature 2018

Authors and Affiliations

  1. 1.Cellular and Molecular Research CenterSabzevar University of Medical SciencesSabzevarIran
  2. 2.Department of Medical Parasitology and Mycology, School of MedicineMashhad University of Medical SciencesMashhadIran
  3. 3.Cutaneous Leishmaniasis Research Center, Faculty of MedicineMashhad University of Medical SciencesMashhadIran
  4. 4.Institute of Immunology and Infectious DiseasesIran University of Medical SciencesTehranIran

Personalised recommendations